Gm C. G. 4:13. Midnight Quickie x Rocket Rockers - Ingin Hilang Ingatan (Official Music Video) Chords: F. G. Am. COMINGSOON on 18 August 2015 Official Music Video Bersama Taklukan Dunia (Breakout NET TV 15.00 WIB)Special thx to :Gania AliandaTile Preman PensiunAl Kauts OfficialMusic Video BERSAMA TAKLUKAN DUNIA 2nd single taken from 5th album of Rocket Rockers MEREKAM JEJAK OUT NOW! 5th Album of Rocket Rockers MEREK F# E B G# D#m G#m C# G D# C C#m] Chords for Rocket Rockers HD LIVE - Reaksi Rasa - Bersama Taklukkan Dunia with song key, BPM, capo transposer, play along with guitar, piano, ukulele & mandolin. 8Lt6LR. C G Am Gteringat kembali satu permainan F C Dm Gyang sering dirimu dan aku mainkan C G Am Graihlah tanganku, genggam jabat erat F C Dm Gmenari bersama, tertawa ceria Am Gdan ku kembali demi masa lalu Dm Gkawan sejati takkan pernah pergiReff C G Amjangan ragu kawanku tuk singgahi tempat ini F G Cmenyanyikan lagu kesenangan sepenuh hati C G Amberdua kita lewati jalan yang terjal berlubang F G Cbersama kita taklukkan duniahari-hari bahagia, senyum lepas dan tawaobati luka lama yang menyiksait's okay tuk berbeda, jangan lelah mencobabuka mata, dengar rasaberpegangan terbang tinggi, tuk menyapa sang pelangigapai semua mimpi-mimpi, jangan tertidur kembali Am Gdan ku kembali demi masa lalu Dm Gkawan sejati takkan pernah pergiReff C G Amjangan ragu kawanku tuk singgahi tempat ini F G Cmenyanyikan lagu kesenangan sepenuh hati C G Amberdua kita lewati jalan yang terjal berlubang F G Cbersama kita taklukkan duniaReff C G Amjangan ragu kawanku tuk singgahi tempat ini F G Cmenyanyikan lagu kesenangan sepenuh hati C G Amberdua kita lewati jalan yang terjal berlubang F G Cbersama kita taklukkan dunia album Simplified info_outline Major & minor chords only visibility 123 album Advanced info_outline Includes 6,7,aug,hdim7 chords visibility 123 album Bass info_outline Advance chords for bass visibility 123 album Edited info_outline All Edited versions visibility 123 album Chords Notes info_outline Notes in chords visibility 123 album Simple Notes info_outline Rhythm of the song visibility 123 album Bass Notes info_outline Sheet music of bass visibility 123 album Music Notes info_outline Sequence of instrument notes visibility 123 close aspect_ratio arrow_drop_down Show all diagrams layers Edit Lyrics cloud_done Save cancel Cancel Edit delete_forever Delete this Version 3/4Time Signature arrow_back0SHIFT arrow_forward BPM doneclose CCFmCCCCCACFCCCCCCCCCCCCFCCCCCFCCCCCFCCCFCAmCCCFCCCCCGCCCACCCGCCCCCCCCCFCCCCCCCCCCCCCCCCCCCDmCACCCFCCCACFCCCCCCCFCCCCCACFCCCDmCCCCCFCCCCCCCCCACCFCCACCCFCCCCACCCCCCCCCCGCCCACCCCGmCCACCCCCACFCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCGCACFCCCCCFCCCCGCCACCCCCCCFCCCCCCGCACCCCCCCFCCCCGCCACCCCCCCFCCCGCCCACCCCCCCFCCCGCCCACCCCCCCFCCCGCCCCCACCCCCFCCCCGCCACCCCCCCCFCCCCFCACFCCCFCACFCCCCDmCCCCFCCCCCCCCCCCCFCCCCCCCCCCCCFCCCCCFCCDmCCCACCCCCCCCCCCCCCCCCCCCCCCCCCN Private lock Publiclanguage file_download PDF & Tabs music_note Download Midi clear ChordU Learn Any Instrument ChordU has always been about simplicity and ease of access. We are constantly improving our accuracy through research and development. We hope you have a wonderful experience with us. Hello Again !! Please login to your ChordU account. mail Login with Email Forgot Password? Don't have an account? Sign Up trending_flat clearsecurity Forgot Password No worries, enter your registered email to reset your password keyboard_backspace Back to Login

chord rocket rockers bersama taklukan dunia